EPPO-Q-bank

A database to support plant pest diagnostic activities

Generic and semi-generic tests 

The generic plant virus tests listed below should not be considered as curated diagnostic protocols. These are rather tests that have been published for a first characterization of viral infections. They can allow, in particular together with direct sequencing of (RT-)PCR products, a first assignment of the viruses in a sample to a specific genus or possibly even down to the species level. However, further specific tests may be required for an unambiguous identification. Please note that indicated tests usually will not detect all species in a particular genus. For details see references.

Group targeted

Type

Oligo nucleotides (5’-3’)

Reference

Badnavirus

PCR

BadnaFP: ATGCCITTYGGIAARAAYGCICC

BadnaRP: CCAYTTRCAIACISCICCCCAICC

Yang IC et al (2003)

Begomovirus

DNA-A

PCR

PAL1v1978B: GCATCTGCAGGCCCACATBGTYTTHCCNGT

PAR1c715H: GATTTCTGCAGTTDATRTTHTCRTCCATCCA

Tsai et al (2011)

Begomovirus

DNA-B

PCR

DNABLC1: GTVAATGGRGTDCACTTCTG

DNABLC2: RGTDCACTTCTGYARGATGC

DNABLV2: GAGTAGTAGTGBAKGTTGCA

Tsai et al (2011)

Begomovirus

ß-satellites

PCR

Beta01: GGTACCACTACGCTACGCAGCAGCC

Beta02: GGTACCTACCCTCCCAGGGGTACAC

Briddon et al (2002)

Begomovirus

PCR

DengA: TAATATTACCKGWKGVCCSC)

DengB: TGGACYTTRCAWGGBCCTTCACA

Deng et al (1994)

Begomovirus

PCR

AV494: GCCYATRTAYAGRAAGCCMAG

AC1048: GGRTTDGARGCATGHGTACATG

Wyatt and Brown (1996).

Carlavirus

RT-PCR

Carla CPGGBYTNGGBGTNCCNACNGA

Poly-T cctcgggcagtcctttttttttttttttttt

Gaspara et al (2008) 

Caulimovirus

PCR

Caulimo 3CPf GAARRHCATTATGCMAAYGARTGTCC

C4281 WWGGRTTTTCWRAACWWACT

Pappu and Druffel (2009)

Nepovirus

Subgroup A

RT-PCR

NepoA-F: ACDTCWGARGGITAYCC

NepoA-R: RATDCCYACYTGRCWIGGCA

Wei and Clover (2008)

EPPO (2017) PM7/2(2), Appendix 2

Nepovirus

Subgroup B

RT-PCR

NepoB-F TCTGGITTTGCYTTRACRGT

NepoB-R CTTRTCACTVCCATCRGTAA

Wei and Clover G (2008)

Orthotospovirus

RT-PCR

gL3637 CCTTTAACAGTDGAAACAT

gL4435c CATDGCRCAAGARTGRTARACAGA

Chu et al (2001)

Orthotospovirus


Asian clade 1 and

Eurasian clade



American clade 1 (not all TSWV isolates)


Asian clade 2



LNRV



American clade 2

RT-PCR


A




B




C



D



E



AS-EA-F: GGG GGA TCC AGA GCA ATC GAG G

AS1-R: GCT TCA GTC CTC TTA AAT GTC C

EA-R: TTG TTC AAT GAA GCA GCA CC


AM1-F: GGG GGA TCC AGA GCA ATT GTG TC

AM1-R: CTT TGC TTT TCA GCA CAG TGC A



AS-EA-F: GGG GGA TCC AGA GCA ATC GAG G

AS2-R: CTT TGA AGA TGA CCT CAT CT


LNRV-F: CCA GTA AAA GAC GAA ATC CC

LNRV-R: GAT TCA AAT CGC CCA GCA GTC C


AM2-F: GGG GGA TCC AGA GCA ATC GG

AM2-R1: GCA ACT CTA CCA GCT TG

AM2-R2: GCA ACT TTA GCA GCT TG

Hassani-Mehraban et al (2016)

EPPO (2020) PM7/139(1), Appendix 4

Plant internal DNA control (COX)

Real-time PCR

COX-F: CGTCGCATTCCAGATTATCCA

COX-R: CAACTACGGATATATAAGAGCCAAAACTG

COX-P TGCTTACGCTGGATGGAATGCCCT-VIC

Weller et al (2000)

Plant internal RNA control

RT-PCR

nad5-s: GATGCTTCTTGGGGCTTCTTGTT

nad5-as: CTCCAGTCACCAACATTGGCATAA

Menzel et al (2002)

Polerovirus

RT-PCR

Polero s2 ATCACITTCGGGCCGWSTCTATCAGA

Polero as3 CACGCGTCIACCTATTTIGGRTTITG

Abraham et al (2006)

Polerovirus

RT-PCR

Gen-1: CTCAARGCCTACCATGARTATAARATC

Gen-2: CGTCTACCTATTTNGGRTTNTG

Knierim et al (2013)

Pospiviroid

RT-PCR


A



B



Pospi1-FW: GGG ATCCCCGGGGAAAC

Pospi1-RE: AGCTTCAGTTGTWTCCACCGGGT


pCLVR4: GGGGCAACTCAGACCGAG C

pCLV4: GGGGCTCCTGAGACCGCTCTTG

EPPO (2021) PM7/138(1), Appendix 2


Verhoeven et al (2004) 



Spieker (1996)


Pospiviroid

RT-PCR

Pospi2-FW: ACCCGGTGGAWACAACTGAAGCT

Pospi2-RE: GGTTTCCCCGGGGATCC

Verhoeven et al (2017)

Potexvirus

RT-PCR

Potex 5: CAYCARCARGCMAARGAYGA

Potex 1RC : TCAGTRTTDGCRTCRAARGT

Potex 2RC: AGCATRGCNSCRTCYTG

Van der Vlugt and Berendsen M (2002)

Potyvirus

RT-PCR

CPUP: TGAGGATCCTGGTGYATHGARAAYGG

P9502: GCGGATCCTTTTTTTTTTTTTTTTT

Van der Vlugt et al (1999)

Potyvirus

RT-PCR

Sprimer: GGNAAYAAYAGYGGNCARCC

M4T: GTTTTCCCAGTCACGACTTTTTTTTTTTTTTT

M4: GTTTTCCCAGTCACGAC

Chen et al (2001)

Potyvirus

RT-PCR

CIFor: GGIVVIGTIGGIWSIGGIAARTCIAC

CIRev: ACICCRTTYTCDATDATRTTIGTIGC

Ha et al (2008)

Rhabdovirus

RT-PCR

Rhab-F: GGATMTGGGGBCATCC

Rhab-R: GTCCABCCYTTTTGYC

Dietzgen et al. (2013)

Tobamovirus

RT-PCR

Tobamo-s1: GGGAATCAGTTTCAAACRCA

Tobamo-as1: GGGGGGATTCGAACCYCT

Menzel Wet al (2019)

Tobamovirus

RT-PCR

TobamodF: TKGAYGGNGTBCCNGGNTGYGG

TobamodR: ACNGAVTBNABCTGTAATTGCTAT

Li et al (2018)

Tombusvirus

RT-PCR

Cir1: GACTCCGCCGTAGCTTGACC

Cir2: GGTTTATTGACTTGTTCGTATTCA G

Koenig et al (2004)

Torradovirus (RNA1)

RT-PCR

Torrado-1F: GCWGAYTAYTCMAGYTTTGATGG

Torrado-1R: GGWACWGCMACHAGRTTGTCATC

Verbeek et al (2012)

Torradovirus (RNA2)

RT-PCR

Torrado-2F: TGGGATGARTGYAATGTKCT

Torrado-2R: CCWGTCCACCAYTTGCAATT

Verbeek et al (2012) 

Tymovirus

RT-PCR

EM13: CCTTCAACTGTGATGTTCATG

EM14: TGCAGATTGTCCCACGC

Kreuze et al (2013)

EPPO (2018) PM7/132(1), Appendix 3


References

Abraham AD, Menzel W, Lesemann DE, Varrelmann M, Vetten HJ (2006) Chickpea chlorotic stunt virus: A new polerovirus infecting cool-season food legumes in Ethiopia. Phytopathology 96:437-446.

Briddon RW, Bull SE, Mansoor S, Amin I, Markham PG (2002) Universal primers for PCR-mediated amplification of DNA β. Mol Biotech 20:315–318.

Chen J, Chen J, Adams MJ (2001) A universal PCR primer to detect members of the Potyviridae and its use to examine the taxonomic status of several members of the family. Arch Virol, 146:757-766.

Chu FH, Chao CH, Chung MH, Chen CC, Yeh SD (2001) Completion of the Genome Sequence of Watermelon silver mottle virus and Utilization of Degenerate Primers for Detecting Tospoviruses. Phytopathology 91:361-368.

Deng D, McGrath PF, Robinson DJ, Harrison BD (1994) Detection and differentiation of whitefly-transmitted geminivirusen in plants and vector insects by the polymerase chain reaction with degenerate primers. Annals of Applied Biology 125: 327-336.

Dietzgen RG, Tan ER, Yong AHS et al (2013) Partial polymerase gene sequence, phylogeny and RT-PCR diagnostic assay for Datura yellow vein nucleorhabdovirus. Australasian Plant Dis Notes 8, 21–25.

EPPO PM7/2(2) Tobacco ringspot virus, Appendix 2. https://onlinelibrary.wiley.com/doi/epdf/10.1111/epp.12376

EPPO PM7/132(1) Andean potato latent virus and Andean potato mild mosaic virus, Appendix 3. https://onlinelibrary.wiley.com/doi/epdf/10.1111/epp.12513

EPPO PM7/138(1) Pospiviroids, Appendix 2. https://onlinelibrary.wiley.com/doi/10.1111/epp.12717 

EPPO PM7/139 Tospoviruses, Appendix 4. https://onlinelibrary.wiley.com/doi/epdf/10.1111/epp.12676 

Gaspara JO, Belintania P, Almeidab AMR, Kitajimac EW (2008) A degenerate primer allows amplification of part of the 3′-terminus of three distinct carlavirus species. J Virol Methods 148: 283-285.

Ha C, Coombs S, Revill PA, Harding RM, Vu M, Dale JL. (2008) Design and application of two novel degenerate primer pairs for the detection and complete genomic characterization of potyviruses. Arch Virol 153: 25–36.

Hassani-Mehraban A, Westenberg M, Verhoeven JTJ, van de Vossenberg BTLH, Kormelink R, Roenhorst JW (2016) Generic RT-PCR tests for detection and identification of tospoviruses. J Virol Methods 233: 89-96.

Knierim D, Tsai W, Kenyon L (2013) Analysis of sequences from field samples reveals the presence of the recently described pepper vein yellows virus (genus Polerovirus) in six additional countries. Arch Virol 158:1337–1341.

Koenig R, Verhoeven JT, Fribourg CE, Pfeilstetter E, Lesemann DE (2004) Evaluation  of various species demarcation criteria in attempts to classify ten new tombusvirus isolates. Arch Virol 49: 1733-1744.

Kreuze J, Koenig R, Souza J, Vetten HR, Muller G, Flores B, Ziebell H, Cuellar W (2013) The complete genome sequences of a Peruvian and a Colombian isolate of Andean potato latent virus and partial sequences of further isolates suggest the existence of two distinct potato-infecting tymovirus species. Virus Research 173: 431-435.

Li Y, Tan G, Lan P, Zhang A, Liu Y, Li R, Li F (2018) Detection of tobamoviruses by RT-PCR using a novel pair of degenerate primers. J Virol Methods 259:122–128.

Menzel W, Jelkmann W, Maiss E (2002): Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. J Virol Methods 99:81-92.

Menzel W, Knierim D, Winter S, Hamacher J, Heupel M (2019) First report of tomato brown rugose fruit virus infecting tomato in Germany. New Disease Reports 39:1.

Pappu HR, Druffel KL (2009) Use of conserved genomic regions and degenerate primers in a PCR-based assay for the detection of members of the genus Caulimovirus. J Virol Methods 157:102-104.

Spieker RL (1996) A viroid from Brunfelsia undulata closely related to the Columnea latent viroid. Arch Virol 141: 1823-1832.

Tsai WS, Shiha SL, Kenyon L, Green SK, Jan FJ (2011) Temporal distribution and pathogenicity of thepredominant tomato-infecting begomoviruses in Taiwan. Plant Pathology 60: 787–799.

Van der Vlugt RAA, Steffens P, Cuperus C, Barg E, Lesemann D-E, Vetten HJ (1999) Further evidence that Shallot yellow stripe virus (SYSV) is a distinct potyvirus and reidentification of Welsh onion yellow stripe virus as a SYSV strain Phytopathology 89: 148-155.

Van der Vlugt RAA & Berendsen M (2002) Development of a general potexvirus detection method. Eur J Plant Path 108: 367-371.

Verbeek M, Tang J, Ward LI (2012) Two generic PCR primer sets for the detection of members of the genus Torradovirus. J Virol Methods 185: 184–188.

Verhoeven JTJ, Jansen CCC, Willemen TM, Kox LFF, Owens RA & Roenhorst JW (2004) Natural infections of tomato by Citrus exocortis viroid, Columnea latent viroid, Potato spindle tuber viroid and Tomato chlorotic dwarf viroid. Eur J Plant Pathol 110: 823–831.

Verhoeven JThJ, Koenraadt HMS, Westenberg M, Roenhorst JW (2017) Characterization of tomato apical stunt viroid isolated from a 24-years old seed lot of Capsicum annuum. Arch Virol 162: 1741–1744.

Wei T, Clover G (2008) Use of primers with 5' non-complementary sequences in RT-PCR for the detection of nepovirus subgroups A and B. J Virol Methods 153:16-21. doi: 10.1016/j.jviromet.2008.06.020. PMID: 18639585.

Weller SA, Elphinstone JG, Smith NC, Boonham N, Stead DE. Detection of Ralstonia solanacearum strains with a quantitative, multiplex, real-time, fluorogenic PCR (TaqMan) assay. Appl Environ Microbiol 66:2853-2858. doi:10.1128/aem.66.7.2853-2858.2000.

Wyatt SD, Brown JK (1996) Detection of Subgroup III Geminivrirus isolates in leaf extracts by degenerate primers and polymerase chain reaction. Phytopathology 86: 1288-1293.

Yang IC, Hafner GJ, Revill PA, Dale JL, Harding RM (2003) Sequence diversity of South Pacific iso-lates of Taro bacilliform virus and the development of a PCR-based diagnostic test. Arch Virol 148:1957-1968.