EPPO-Q-bank

A database to support plant pest diagnostic activities

The barcoding protocol for recA for Erwinia amylovora


Conventional PCR recA for Erwinia amylovora. 

The test is based on PCR amplification and sequencing of 737 bp (amplicon including primers) of the recA gene and can be used for the identification of Erwinia amylovora. The test is adapted from Waleron et al., 2008. The recA gene encodes the DNA recombination/repair protein RecA which catalyses an ATP-dependent DNA strand-exchange reaction, a critical step in the repair of DNA double-strand breaks by homologous recombination. It is located on the chromosome.

The bacterial recA gene is a protein coding sequence (CDS) for which translation table 11 (The Bacterial, Archaeal and Plant Plastid Code) applies.


Primer sequences and their application are given in the table below.


Primer name

Primer sequence (5’- 3’ orientation)

Primer used for

PCR

Sequencing

 recA-Ea-F

 GGTAAAGGGTCTATCATGCG

x

x

 recA-Ea-R*

 CCTTCACCATACATAATCTGGA

x

x

* Based on in silico analysis of recA sequences from Erwinia amylovora, the published recA-R primer was modified (C for T) at position 5 from the 3’ end to improve amplification.


Master mixes are prepared according to the table below. 


Reagent

Working concentration

Volume per reaction (µL) 

Final concentration

 Molecular grade water

N.A.

5.5

N.A.

 Bioline MyFi Mix*

2 x

12.5

1 x

 recA-Ea-F

10 µM

1.0

0.2 µM

 recA-Ea-R

10 µM

1.0

0.2 µM

 Subtotal


20.0 


 Genomic DNA extract 

10 ng/µL

5.0


 Total


25.0 

 

*  The MyFiTM Mix is supplied as a 2x formulation containing MyFi DNA Polymerase, dNTPs, MgCl2 and enhancers at optimal concentrations. Other verified PCR master mixes containing a polymerase with proof reading activity are also fit for purpose. 



 

Thermocycler profile: 1 min at 95°C then 30x [30 s at 95°C, 30 s at 47°C, 45 s at 72°C], 5 min at 72°C, hold at 4°C.

Amplicon sequencing is done with the PCR primers. 

The recA amplicon (737 bp including primers) in the type strain of Erwinia amylovora (CFBP 1232T, LMG 2024T, NCPPB 683T) extends from position 67 to position 803 included on the positive strand of the gene (1068 bp). 

The recA barcode (690 nt) extends from position 89 to position 778 included on the positive strand of the gene. The recA barcode starts with TGGGTGAAG and ends with AGCAGGCTG. 


See appendix 7 of PM7/129 for guidance on data-analysis.

 

Performance characteristics

Analytical sensitivity 

Cell pellets of pure cultures are used for the DNA extraction (section 2.1).  

DNA concentration of approximately 1.1 ng/µL is sufficient to generate an amplicon that can be sequenced, leading to a consensus sequence with a HQ (Phred > 40) of at least 84%.


Analytical specificity

The recA amplicon was produced for 97 strains of Erwinia amylovora from worldwide origin and from various host plants.

The recA PCR is however not exclusive for Erwinia amylovora. Other Erwinia species, Brenneria and Lonsdalea species will also produce the recA amplicon but can be reliably differentiated by the DNA barcode sequence.


Selectivity

Selectivity does not apply as pure cultures are used.


Reproducibility data

The DNA samples were processed by different persons. Therefore in this situation the reproducibility is identical to diagnostic sensitivity.